This function uses the PHYLIP package to make phylogenetic analysis. For making trees it uses maximum parsimony methods.

repClonalFamily(.data, .threads, .nofail)

Arguments

.data

The data to be processed. Can be output of repAlignLineage() with normal or verbose output; variants with one sample and list of samples are both supported.

.threads

Number of threads to use.

.nofail

Returns NA instead of stopping if PHYLIP is not installed. Used to avoid raising errors in examples on computers where PHYLIP is not installed.

Value

Dataframe or list of dataframes (if input is a list with multiple samples). The dataframe has these columns: * Cluster: cluster name * Germline.Input: germline sequence, like it was in the input; not trimmed and not aligned * V.germline.nt: input germline V gene sequence * J.germline.nt: input germline J gene sequence * CDR3.germline.length: length of CDR3 in input germline * V.length: length of V gene after trimming on repAlignLineage() step * J.length: length of j gene after trimming on repAlignLineage() step * Germline.Output: germline sequence, parsed from PHYLIP dnapars function output; it contains difference of germline from the common ancestor; "." characters mean matching letters. It's usually shorter than Germline.Input, because germline and clonotype sequences were trimmed to the same length before alignment. * Common.Ancestor: common ancestor sequence, parsed from PHYLIP dnapars function output * Trunk.Length: mean trunk length, representing the distance between the most recent common ancestor and germline sequence as a measure of the maturity of a lineage * Tree: output tree in "phylo" format, loaded from by PHYLIP dnapars function output * TreeStats: nested dataframe containing data about tree nodes, needed for visualization * Sequences: nested dataframe containing all sequences for this combination of cluster and germline; it contains regions from original sequences, saved for repSomaticHypermutation() calculation, and also data needed for visualizations

Examples


data(bcrdata)
bcr_data <- bcrdata$data

bcr_data %>%
  seqCluster(seqDist(bcr_data), .fixed_threshold = 3) %>%
  repGermline(.threads = 1) %>%
  repAlignLineage(.min_lineage_sequences = 2, .align_threads = 2, .nofail = TRUE) %>%
  repClonalFamily(.threads = 1, .nofail = TRUE)
#> Warning: Alleles IGHV4-55*01 from sample full_clones not found in the reference and will be dropped!
#> Probably, species argument is wrong (current value: HomoSapiens) or the data contains non-BCR genes.
#> $full_clones
#>                              Cluster
#> 1 IGHV4-61/IGHJ4_length_45_cluster_1
#> 2 IGHV4-61/IGHJ4_length_63_cluster_1
#> 3 IGHV5-51/IGHJ4_length_60_cluster_1
#> 4 IGHV5-51/IGHJ5_length_45_cluster_1
#>                                                                                                                                                                                                                                                                                                                                                                                   Germline.Input
#> 1                   CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#> 2 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#> 3       GAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#> 4                      GAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#>                                                                                                                                                                                                                                                                                      V.germline.nt
#> 1 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTAC
#> 2 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTAC
#> 3    GAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTAC
#> 4    GAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTAC
#>                     J.germline.nt CDR3.germline.length V.length J.length
#> 1 GGCCAAGGAACCCTGGTCACCGTCTCCTCAG                   45      165       31
#> 2 GGCCAAGGAACCCTGGTCACCGTCTCCTCAG                   63      147       31
#> 3 GGCCAAGGAACCCTGGTCACCGTCTCCTCAG                   60      150       31
#> 4 GGCCAAGGAACCCTGGTCACCGTCTCCTCAG                   45      165       31
#>                                                                                                                                                                                                                                     Germline.Output
#> 1 CCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#> 2 GAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#> 3 GAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#> 4 CCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#>                                                                                                                                                                                                                                     Common.Ancestor
#> 1 CCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCCATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGTTGACCTCTGTGACCGCTGCGGACACGGCCGTGTATTTCTGTGCGAGAGGCGCCGGGGACTACRSCACTCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG
#> 2 GAGTGGATTGGGTATATCTATTACAGTGGGAGTACCAACTACAACCCCTCCCTCAAGAGTCGAGTCAGCATATCATTAGACACGTCCAAGAACCAGTTCTCCCTGAACCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTTTTGTGCGAGAGATCATCACAGTTTCTATGATACWAGTGGTTATTATCCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG
#> 3 GAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGACCAGGTCACCATGTCAGTCGGCAAGTCCATCGGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGTRAGACACTCTGGTAAGATAGAATCATCTGTGGGCCCCAGAASCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG
#> 4 CCCGGGAAAGGCCTGGAGTGGDTGGGGABCATCTATCCTCGTGACTCTGATACCAGATACAGTCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATVTATTACTGTRCGAGACAACACCCTTTAGATAGTCGTGTCTGGTACACTTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG
#>   Trunk.Length
#> 1            6
#> 2            7
#> 3            6
#> 4            6
#>                                                                       Tree
#> 1   4, 4, 4, 1, 2, 3, 0.04149, 0.04979, 0.0249, 1, ID_643, ID_42, Germline
#> 2 4, 4, 4, 1, 2, 3, 0.02282, 0.00207, 0.02905, 1, ID_123, ID_119, Germline
#> 3  4, 4, 4, 1, 2, 3, 0.01245, 0.00415, 0.0249, 1, ID_792, ID_416, Germline
#> 4 4, 4, 4, 1, 2, 3, 0.04772, 0.06017, 0.02075, 1, ID_987, ID_283, Germline
#>                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TreeStats
#> 1  CommonAncestor_1, ID_643, ID_42, Germline, CommonAncestor, Clonotype, Clonotype, Germline, 1, 301, 26, 1, Germline, CommonAncestor_1, CommonAncestor_1, NA, 6, 15, 17, 0, 4, 9, 12, 0, CCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCCATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGTTGACCTCTGTGACCGCTGCGGACACGGCCGTGTATTTCTGTGCGAGAGGCGCCGGGGACTACRSCACTCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG, CCCCCAGGGAAGGGACTGGAGTGGATTGGATATATTCATTACAGTGGGAACTCCTTCTACAACCCCTCCCTCAAAAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAGGTTGACCTCTGTGACCGCTGCGGACACGGCCGTGTATTTCTGTGCGAGAGGCGCCGGGGACTACGCCACTCCCTTTGACTACTGGGGCCCGGGAACCCTGGTCACCGTCTCCTCAG, CCCCCAGGGAAGGGACTGGAGTGGATTGGGTATGTCCATCACAGTGGGAGCACCAATTACAATCCCTCCCTCAAGCGTCGAGTCACCATGTCAGTAGACACGGCCAGGAAGCAGTTGTCCCTGAAATTGACCTCTGTGACCGCTGCGGACACGGCCGTGTATTTCTGTGCGAGAGGCGCCGGGGACTACAGCACTCCCTTTGACTACTGGGGCCAGGGAGCCCTGGTCACCGTCTCCTCAG, CCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#> 2   CommonAncestor_1, ID_123, ID_119, Germline, CommonAncestor, Clonotype, Clonotype, Germline, 1, 53, 290, 1, Germline, CommonAncestor_1, CommonAncestor_1, NA, 7, 12, 7, 0, 4, 7, 4, 0, GAGTGGATTGGGTATATCTATTACAGTGGGAGTACCAACTACAACCCCTCCCTCAAGAGTCGAGTCAGCATATCATTAGACACGTCCAAGAACCAGTTCTCCCTGAACCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTTTTGTGCGAGAGATCATCACAGTTTCTATGATACWAGTGGTTATTATCCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG, GAGTGGATTGGGAATATCTATTACAGTGGGACTACCAACTACAACCCCTCCCTCAAGAGTCGAGTCAGCATATCCTTAGACACGTCCAAGAACCAGTTCTCCCTGACCCTGAGGTCTGTGACCGCTGCGGACACGGCCGTGTATTTTTGTGCGAGAGATCATCACAGTTTCTATGATACAAGTGGTTATTATCCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG, GAGTGGATTGGGTATATCTATTACAGTGGGAGTACCAACTACAACCCCTCCCTCAAGAGTCGAGTCAGCATATCATTAGACACGTCCAAGAACCAGTTCTCCCTGAACCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTTTTGTGCGAGAGATCATCACAGTTTCTATGATACTAGTGGTTATTATCCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG, GAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#> 3    CommonAncestor_1, ID_792, ID_416, Germline, CommonAncestor, Clonotype, Clonotype, Germline, 1, 777, 21, 1, Germline, CommonAncestor_1, CommonAncestor_1, NA, 6, 8, 6, 0, 5, 6, 5, 0, GAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGACCAGGTCACCATGTCAGTCGGCAAGTCCATCGGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGTRAGACACTCTGGTAAGATAGAATCATCTGTGGGCCCCAGAASCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG, GAGTGGATGGGAATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGACCAGGTCAGCATGTCAGTCGGCAAGTCCATCGGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGTAAGACACTCTGGTAAGATAGAATCATCTGTGGGCCCCAGAACCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG, GAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGACCAGGTCACCATGTCAGTCGGCAAGTCCATCGGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGTGAGACACTCTGGTAAGATAGAATCATCTGTGGGCCCCAGAAGCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG, GAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#> 4 CommonAncestor_1, ID_987, ID_283, Germline, CommonAncestor, Clonotype, Clonotype, Germline, 1, 57, 184, 1, Germline, CommonAncestor_1, CommonAncestor_1, NA, 6, 15, 18, 0, 4, 7, 10, 0, CCCGGGAAAGGCCTGGAGTGGDTGGGGABCATCTATCCTCGTGACTCTGATACCAGATACAGTCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATVTATTACTGTRCGAGACAACACCCTTTAGATAGTCGTGTCTGGTACACTTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG, CCCGGGAAAGGCCTGGAGTGGTTGGGGAGCATCTACCCTCGTGACTCTGACACTAGATACAGTCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCCTCAGTACCGCCTACTTGCAGTGGAACAGCCTGCAGGCCTCGGACACCGCCATCTACTACTGTGCGAGACAACACCCTTTAGATAGTCGTGTCTGGTACACTTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG, CCCGGAAAAGGCCTGGAGTGGGTGGGATCGATCTATCCTCGTGACTCTGATATCAGATACAATCCGTCCTTCCAAGGCCAAGTCACCATCTCAGCCGACAGGTCCACCACCACCGCCTACCTGCAGTGGAGCAGTCTGAAGGCCTCGGACACCGCCATATATTACTGTACGAGACAACACCCTTTAGATAGTCGTGTCTGGTACACTTGGGGCCAGGGAGCCCTGGTCACCGTCTCCTCAG, CCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAAGGAACCCTGGTCACCGTCTCCTCAG
#>                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   Sequences
#> 1                                       CCCCCAGGGAAGGGACTGGAGTGGATTGGGTATGTCCATCACAGTGGGAGCACCAATTACAATCCCTCCCTCAAGCGTCGAGTCACCATGTCAGTAGACACGGCCAGGAAGCAGTTGTCCCTGAAATTGACCTCTGTGACCGCTGCGGACACGGCCGTGTATTTCTGTGCGAGAGGCGCCGGGGACTACAGCACTCCCTTTGACTACTGGGGCCAGGGAGCCCTGGTCACCGTCTCCTCAGGTAA, CCCCCAGGGAAGGGACTGGAGTGGATTGGATATATTCATTACAGTGGGAACTCCTTCTACAACCCCTCCCTCAAAAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAGGTTGACCTCTGTGACCGCTGCGGACACGGCCGTGTATTTCTGTGCGAGAGGCGCCGGGGACTACGCCACTCCCTTTGACTACTGGGGCCCGGGAACCCTGGTCACCGTCTCCTCAGGTAAG, 42, 643, 26, 301, ggtggctccgtcagcagtggtggttactac, ggtggctccgtcagcagtggtggttactac, GTCCATCACAGTGGGAGCACC, ATTCATTACAGTGGGAACTCC, TGTGCGAGAGGCGCCGGGGACTACAGCACTCCCTTTGACTACTGG, TGTGCGAGAGGCGCCGGGGACTACGCCACTCCCTTTGACTACTGG, caggtgcagctgcaggagtcgggcccaggactggtgaagccttcggagaccctgtccctcacctgcactgtctct, caggtgcagctgcaggagtcgggcccaggactggtgaagccttcggagaccctgtccctcacctgcactgtctct, tggagctggatccggcagCCCCCAGGGAAGGGACTGGAGTGGATTGGGTAT, tggagctggatccggcagCCCCCAGGGAAGGGACTGGAGTGGATTGGATAT, AATTACAATCCCTCCCTCAAGCGTCGAGTCACCATGTCAGTAGACACGGCCAGGAAGCAGTTGTCCCTGAAATTGACCTCTGTGACCGCTGCGGACACGGCCGTGTATTTC, TTCTACAACCCCTCCCTCAAAAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAGGTTGACCTCTGTGACCGCTGCGGACACGGCCGTGTATTTC, GGCCAGGGAGCCCTGGTCACCGTCTCCTCAG, GGCCCGGGAACCCTGGTCACCGTCTCCTCAG
#> 2 GAGTGGATTGGGTATATCTATTACAGTGGGAGTACCAACTACAACCCCTCCCTCAAGAGTCGAGTCAGCATATCATTAGACACGTCCAAGAACCAGTTCTCCCTGAACCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTTTTGTGCGAGAGATCATCACAGTTTCTATGATACTAGTGGTTATTATCCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG, GAGTGGATTGGGAATATCTATTACAGTGGGACTACCAACTACAACCCCTCCCTCAAGAGTCGAGTCAGCATATCCTTAGACACGTCCAAGAACCAGTTCTCCCTGACCCTGAGGTCTGTGACCGCTGCGGACACGGCCGTGTATTTTTGTGCGAGAGATCATCACAGTTTCTATGATACAAGTGGTTATTATCCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG, 119, 123, 290, 53, ggtggctccgtcagcagtggtggttactac, ggtggctccgtcagcagtggtggttactac, ATCTATTACAGTGGGAGTACC, ATCTATTACAGTGGGACTACC, TGTGCGAGAGATCATCACAGTTTCTATGATACTAGTGGTTATTATCCCTACTTTGACTACTGG, TGTGCGAGAGATCATCACAGTTTCTATGATACAAGTGGTTATTATCCCTACTTTGACTACTGG, caggtgcagctgcaggagtcgggcccaggactggtgaagccttcggagaccctgtccctcacctgcactgtctct, caggtgcagctgcaggagtcgggcccaggactggtgaagccttcggagaccctgtccctcacctgcactgtctct, tggagctggatccggcagcccccagggaagggactgGAGTGGATTGGGTAT, tggagctggatccggcagcccccagggaagggactgGAGTGGATTGGGAAT, AACTACAACCCCTCCCTCAAGAGTCGAGTCAGCATATCATTAGACACGTCCAAGAACCAGTTCTCCCTGAACCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTTT, AACTACAACCCCTCCCTCAAGAGTCGAGTCAGCATATCCTTAGACACGTCCAAGAACCAGTTCTCCCTGACCCTGAGGTCTGTGACCGCTGCGGACACGGCCGTGTATTTT, GGCCAGGGAACCCTGGTCACCGTCTCCTCAG, GGCCAGGGAACCCTGGTCACCGTCTCCTCAG
#> 3               GAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGACCAGGTCACCATGTCAGTCGGCAAGTCCATCGGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGTGAGACACTCTGGTAAGATAGAATCATCTGTGGGCCCCAGAAGCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA, GAGTGGATGGGAATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGACCAGGTCAGCATGTCAGTCGGCAAGTCCATCGGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGTAAGACACTCTGGTAAGATAGAATCATCTGTGGGCCCCAGAACCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG, 416, 792, 21, 777, ggatacagctttaccagctactgg, ggatacagctttaccagctactgg, ATCTATCCTGGTGACTCTGATACC, ATCTATCCTGGTGACTCTGATACC, TGTGTGAGACACTCTGGTAAGATAGAATCATCTGTGGGCCCCAGAAGCTTTGACTACTGG, TGTGTAAGACACTCTGGTAAGATAGAATCATCTGTGGGCCCCAGAACCTTTGACTACTGG, gaggtgcagctggtgcagtctggagcagaggtgaaaaagcccggggagtctctgaagatctcctgtaagggttct, gaggtgcagctggtgcagtctggagcagaggtgaaaaagcccggggagtctctgaagatctcctgtaagggttct, atcggctgggtgcgccagatgcccgggaaaggcctgGAGTGGATGGGGATC, atcggctgggtgcgccagatgcccgggaaaggcctgGAGTGGATGGGAATC, AGATACAGCCCGTCCTTCCAAGACCAGGTCACCATGTCAGTCGGCAAGTCCATCGGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTAC, AGATACAGCCCGTCCTTCCAAGACCAGGTCAGCATGTCAGTCGGCAAGTCCATCGGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTAC, GGCCAGGGAACCCTGGTCACCGTCTCCTCAG, GGCCAGGGAACCCTGGTCACCGTCTCCTCAG
#> 4                                           CCCGGAAAAGGCCTGGAGTGGGTGGGATCGATCTATCCTCGTGACTCTGATATCAGATACAATCCGTCCTTCCAAGGCCAAGTCACCATCTCAGCCGACAGGTCCACCACCACCGCCTACCTGCAGTGGAGCAGTCTGAAGGCCTCGGACACCGCCATATATTACTGTACGAGACAACACCCTTTAGATAGTCGTGTCTGGTACACTTGGGGCCAGGGAGCCCTGGTCACCGTCTCCTCAGGTAAG, CCCGGGAAAGGCCTGGAGTGGTTGGGGAGCATCTACCCTCGTGACTCTGACACTAGATACAGTCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCCTCAGTACCGCCTACTTGCAGTGGAACAGCCTGCAGGCCTCGGACACCGCCATCTACTACTGTGCGAGACAACACCCTTTAGATAGTCGTGTCTGGTACACTTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG, 283, 987, 184, 57, ggatacagctttaccagctactgg, ggatacagctttaccagctactgg, ATCTATCCTCGTGACTCTGATATC, ATCTACCCTCGTGACTCTGACACT, TGTACGAGACAACACCCTTTAGATAGTCGTGTCTGGTACACTTGG, TGTGCGAGACAACACCCTTTAGATAGTCGTGTCTGGTACACTTGG, gaggtgcagctggtgcagtctggagcagaggtgaaaaagcccggggagtctctgaagatctcctgtaagggttct, gaggtgcagctggtgcagtctggagcagaggtgaaaaagcccggggagtctctgaagatctcctgtaagggttct, atcggctgggtgcgccagatgCCCGGAAAAGGCCTGGAGTGGGTGGGATCG, atcggctgggtgcgccagatgCCCGGGAAAGGCCTGGAGTGGTTGGGGAGC, AGATACAATCCGTCCTTCCAAGGCCAAGTCACCATCTCAGCCGACAGGTCCACCACCACCGCCTACCTGCAGTGGAGCAGTCTGAAGGCCTCGGACACCGCCATATATTAC, AGATACAGTCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCCTCAGTACCGCCTACTTGCAGTGGAACAGCCTGCAGGCCTCGGACACCGCCATCTACTAC, GGCCAGGGAGCCCTGGTCACCGTCTCCTCAG, GGCCAGGGAACCCTGGTCACCGTCTCCTCAG
#> 
#> attr(,"class")
#> [1] "clonal_family" "list"