Repertoire overlap

Repertoire overlap is the most common approach to measure repertoire similarity. It is achieved by computation of specific statistics on clonotypes shared between given repertoires, also called “public” clonotypes. immunarch provides several indices: - number of public clonotypes (.method = "public") - a classic measure of overlap similarity.

  • overlap coefficient (.method = "overlap") - a normalised measure of overlap similarity. It is defined as the size of the intersection divided by the smaller of the size of the two sets.

  • Jaccard index (.method = "jaccard") - it measures similarity between finite sample sets, and is defined as the size of the intersection divided by the size of the union of the sample sets.

  • Tversky index (.method = "tversky") - an asymmetric similarity measure on sets that compares a variant to a prototype. If using default arguments, it’s similar to Dice’s coefficient.

  • cosine similarity (.method = "cosine") - a measure of similarity between two non-zero vectors

  • Morisita’s overlap index (.method = "morisita") - a statistical measure of dispersion of individuals in a population. It is used to compare overlap among samples.

  • incremental overlap - overlaps of the N most abundant clonotypes with incrementally growing N (.method = "inc+METHOD", e.g., "inc+public" or "inc+morisita").

The function that includes described methods is repOverlap. Again the output is easily visualised when passed to vis() function that does all the work:

imm_ov1 <- repOverlap(immdata$data, .method = "public", .verbose = F)
imm_ov2 <- repOverlap(immdata$data, .method = "morisita", .verbose = F)

p1 <- vis(imm_ov1)
p2 <- vis(imm_ov2, .text.size = 2)

p1 + p2

vis(imm_ov1, "heatmap2")

You can easily change the number of significant digits:

p1 <- vis(imm_ov2, .text.size = 2.5, .signif.digits = 1)
p2 <- vis(imm_ov2, .text.size = 2, .signif.digits = 2)

p1 + p2

To analyse the computed overlap measures function apply repOverlapAnalysis.

# Apply different analysis algorithms to the matrix of public clonotypes:
# "mds" - Multi-dimensional Scaling
repOverlapAnalysis(imm_ov1, "mds")
## Standard deviations (1, .., p=4):
## [1] 0 0 0 0
## 
## Rotation (n x k) = (12 x 2):
##                [,1]       [,2]
## A2-i129  18.7767715 -18.360817
## A2-i131 -29.9586985  -7.870441
## A2-i133 -28.1148594  22.629093
## A2-i132  44.3435640   6.221812
## A4-i191 -13.8586515   7.452149
## A4-i192  14.0065477  27.068830
## MS1       8.8469009  -8.151574
## MS2       0.9712073  -1.297017
## MS3      10.4398629   4.894354
## MS4      -0.5131505  10.471309
## MS5     -18.5153823 -12.628029
## MS6      -6.4241122 -30.429669
# "tsne" - t-Stochastic Neighbor Embedding
repOverlapAnalysis(imm_ov1, "tsne")
##               DimI       DimII
## A2-i129   80.58072 -118.583878
## A2-i131   99.90493  389.398726
## A2-i133  -24.10273  -47.636064
## A2-i132 -107.15488    3.392012
## A4-i191 -111.89058  -77.617023
## A4-i192   45.27260 -147.954181
## MS1       53.84511  -81.511064
## MS2      -97.22998  -27.900639
## MS3       59.29022 -115.433687
## MS4      -95.63975  -49.092791
## MS5      119.56156  392.926285
## MS6      -22.43721 -119.987696
## attr(,"class")
## [1] "immunr_tsne" "matrix"      "array"
# Visualise the results
repOverlapAnalysis(imm_ov1, "mds") %>% vis()

# Apply different analysis algorithms to the matrix of public clonotypes:
# "mds" - Multi-dimensional Scaling
repOverlapAnalysis(imm_ov1, "mds")
## Standard deviations (1, .., p=4):
## [1] 0 0 0 0
## 
## Rotation (n x k) = (12 x 2):
##                [,1]       [,2]
## A2-i129  18.7767715 -18.360817
## A2-i131 -29.9586985  -7.870441
## A2-i133 -28.1148594  22.629093
## A2-i132  44.3435640   6.221812
## A4-i191 -13.8586515   7.452149
## A4-i192  14.0065477  27.068830
## MS1       8.8469009  -8.151574
## MS2       0.9712073  -1.297017
## MS3      10.4398629   4.894354
## MS4      -0.5131505  10.471309
## MS5     -18.5153823 -12.628029
## MS6      -6.4241122 -30.429669
# "tsne" - t-Stochastic Neighbor Embedding
repOverlapAnalysis(imm_ov1, "tsne")
##                DimI       DimII
## A2-i129  159.173214   31.740390
## A2-i131 -412.686799  109.302211
## A2-i133   69.250454   11.993658
## A2-i132    2.750179  -45.221274
## A4-i191   34.452349 -110.436119
## A4-i192  142.429023   -5.574571
## MS1      122.911716   50.528482
## MS2       25.483650  -63.648796
## MS3      141.317535   24.867084
## MS4       31.812734  -81.393962
## MS5     -406.023695  125.740068
## MS6       89.129640  -47.897170
## attr(,"class")
## [1] "immunr_tsne" "matrix"      "array"
# Visualise the results
repOverlapAnalysis(imm_ov1, "mds") %>% vis()

# Clusterise the MDS resulting components using K-means
repOverlapAnalysis(imm_ov1, "mds+kmeans") %>% vis()

Public repertoire

In order to build a massive table with all clonotypes from the list of repertoires use the pubRep function.

# Pass "nt" as the second parameter to build the public repertoire table using CDR3 nucleotide sequences
pr.nt <- pubRep(immdata$data, "nt", .verbose = F)
pr.nt
##                                                    CDR3.nt Samples A2-i129
##     1:                   TGCGCCAGCAGCTTGGAAGAGACCCAGTACTTC       8       1
##     2:                   TGTGCCAGCAGCTTCCAAGAGACCCAGTACTTC       7      NA
##     3:                   TGTGCCAGCAGTTACCAAGAGACCCAGTACTTC       7       1
##     4:                   TGCGCCAGCAGCTTCCAAGAGACCCAGTACTTC       6       2
##     5:                      TGTGCCAGCAGCCAAGAGACCCAGTACTTC       6       4
##    ---                                                                    
## 75101:             TGTGCTTCACAACTCTTATTGGACGAGACCCAGTACTTC       1      NA
## 75102: TGTGCTTCACAAGCCCTACAGGGCACTTTCCATAATTCACCCCTCCACTTT       1      NA
## 75103:                   TGTGCTTCAGGGCGGGCCTACGAGCAGTACTTC       1      NA
## 75104:             TGTGCTTCCGCCGGACCGGACCGGGAGACCCAGTACTTC       1      NA
## 75105:                TGTGCTTGCGGGACAGATAACTATGGCTACACCTTC       1      NA
##        A2-i131 A2-i133 A2-i132 A4-i191 A4-i192 MS1 MS2 MS3 MS4 MS5 MS6
##     1:      NA       1       1      NA       1  NA  NA   1   1   1   1
##     2:       1       1       2       1      NA   1  NA  NA   2  NA   1
##     3:       1       1      NA       1       1   1  NA   2  NA  NA  NA
##     4:      NA       1       1      NA      NA  NA   1  NA   1  NA   1
##     5:       2      NA       2       3       1  NA  NA  NA  NA   4  NA
##    ---                                                                
## 75101:       1      NA      NA      NA      NA  NA  NA  NA  NA  NA  NA
## 75102:      NA      NA      NA      NA      NA  NA  NA  NA  NA   1  NA
## 75103:      NA      NA      NA      NA      NA   1  NA  NA  NA  NA  NA
## 75104:      NA       1      NA      NA      NA  NA  NA  NA  NA  NA  NA
## 75105:      NA      NA      NA      NA       1  NA  NA  NA  NA  NA  NA
# Pass "aa+v" as the second parameter to build the public repertoire table using CDR3 aminoacid sequences and V alleles
# In order to use only CDR3 aminoacid sequences, just pass "aa"
pr.aav <- pubRep(immdata$data, "aa+v", .verbose = F)
pr.aav
##                    CDR3.aa   V.name Samples A2-i129 A2-i131 A2-i133 A2-i132
##     1:         CASSLEETQYF  TRBV5-1       8       1      NA       2       1
##     2:     CASSDSSGGANEQFF  TRBV6-4       6       1       1       2      NA
##     3:         CASSFQETQYF  TRBV5-1       6       3      NA       1       1
##     4:         CASSLGETQYF TRBV12-4       6       2      NA      NA       4
##     5:     CASSDSGGSYNEQFF  TRBV6-4       5      NA      NA      NA       3
##    ---                                                                     
## 74440:     CTSSRPTQGAYEQYF  TRBV7-2       1      NA      NA      NA      NA
## 74441:    CTSSSRAGAGTDTQYF  TRBV7-2       1      NA      NA      NA      NA
## 74442: CTSSYPGLAGLKRKETQYF  TRBV7-2       1      NA      NA      NA       1
## 74443:    CTSSYRQRPYQETQYF  TRBV7-2       1      NA      NA      NA      NA
## 74444:      CTSSYSTSGVGQFF  TRBV7-2       1      NA      NA      NA      NA
##        A4-i191 A4-i192 MS1 MS2 MS3 MS4 MS5 MS6
##     1:      NA       2  NA  NA   1   1   1   1
##     2:       3      NA  NA  NA   2  NA  NA  12
##     3:      NA      NA  NA   1  NA   1  NA   1
##     4:       3      NA   1  NA  NA  NA   2   1
##     5:      NA       1   1  NA   1  NA  NA   1
##    ---                                        
## 74440:      NA      NA  NA  NA  NA  NA  NA   1
## 74441:      NA      NA  NA  NA   1  NA  NA  NA
## 74442:      NA      NA  NA  NA  NA  NA  NA  NA
## 74443:      NA      NA  NA  NA   1  NA  NA  NA
## 74444:      NA      NA  NA  NA  NA   1  NA  NA
# You can also pass the ".coding" parameter to filter out all noncoding sequences first:
pr.aav.cod <- pubRep(immdata$data, "aa+v", .coding = T)
# Create a public repertoire with coding-only sequences using both CDR3 amino acid sequences and V genes
pr <- pubRep(immdata$data, "aa+v", .coding = T, .verbose = F)

# Apply the filter subroutine to leave clonotypes presented only in healthy individuals
pr1 <- pubRepFilter(pr, immdata$meta, c(Status = "C"))

# Apply the filter subroutine to leave clonotypes presented only in diseased individuals
pr2 <- pubRepFilter(pr, immdata$meta, c(Status = "MS"))

# Divide one by another
pr3 <- pubRepApply(pr1, pr2)

# Plot it
p <- ggplot() +
  geom_jitter(aes(x = "Treatment", y = Result), data = pr3)
p